Composite
Part:BBa_K4968017:Design
Designed by: Shouye Zhu Group: iGEM23_XJTLU-CHINA (2023-10-09)
CBM-sfGFP-pUC_GW_KanR-SUMO
Assembly Compatibility:
- 10INCOMPATIBLE WITH RFC[10]Illegal EcoRI site found at 3885
- 12INCOMPATIBLE WITH RFC[12]Illegal EcoRI site found at 3885
- 21INCOMPATIBLE WITH RFC[21]Illegal EcoRI site found at 3885
Illegal XhoI site found at 1078 - 23INCOMPATIBLE WITH RFC[23]Illegal EcoRI site found at 3885
- 25INCOMPATIBLE WITH RFC[25]Illegal EcoRI site found at 3885
Illegal AgeI site found at 487 - 1000INCOMPATIBLE WITH RFC[1000]Illegal BsaI site found at 93
Illegal BsaI site found at 3760
Illegal BsaI.rc site found at 86
Source
The segment CBM-sfGFP-pUC_GW_KanR-SUMO was obtained from the pUC_GW_Kan-SUMO-SmtA-CBM-sfGFP plasmid using PCR technology with Primer 1 (AGATCCTGATCCAGAGCCGC) and Primer 2 (GCACCAGGTTGTCGTGTAGACT). Linker between CBM and sfGFP: GGGSPTGG.